Full détail and Blast détails available on pages 38 and 39 of thé perez &Montagnier article
TO BE READ WITH
Monday, August 17, 2020
Dr Paul Tambyah, senior consultant NUS & president-elect of the International Society of Infectious Diseases, says COVID D614G mutation in some parts of the world has coincided with a drop in death rates, suggesting it is less lethal: Are Australia's elimination type lockdown policies destroying health and the economy?
by Ganesh Sahathevan
Reuters and others have reported:
Dr Paul Tambyah, senior consultant at the National University of Singapore and president-elect of the US-based International Society of Infectious Diseases, said the D614G mutation has also been found in Singapore.
TO BE READ WITH
Infectious Covid-19 mutation may be 'a good thing', says disease expert Paul Tambyah
Dr Paul Tambyah, senior consultant at the National University of Singapore and president-elect of the US-based International Society of Infectious Diseases, said the D614G mutation has also been found in Singapore.
Published18 AUGUST, 2020UPDATED 18 AUGUST, 2020
SINGAPORE — An increasingly common mutation of the novel coronavirus found in Europe, North America and parts of Asia may be more infectious but appears less deadly, according to a prominent infectious diseases doctor.
Dr Paul Tambyah, senior consultant at the National University of Singapore and president-elect of the International Society of Infectious Diseases, said evidence suggests the proliferation of the D614G mutation in some parts of the world has coincided with a drop in death rates, suggesting it is less lethal.
"Maybe that's a good thing to have a virus that is more infectious but less deadly," Dr Tambyah told Reuters.
Dr Tambyah said most viruses tend to become less virulent as they mutate.
"It is in the virus' interest to infect more people but not to kill them because a virus depends on the host for food and for shelter," he said.
Scientists discovered the mutation as early as February and it has circulated in Europe and the Americas, the World Health Organization said. The WHO has also said there is no evidence the mutation has led to more severe disease.
On Sunday (Aug 16), Malaysia's director-general of health Noor Hisham Abdullah urged greater public vigilance after authorities detected what they believe was the D614G mutation of the coronavirus in two recent clusters.
Dr Sebastian Maurer-Stroh of Singapore's Agency for Science, Technology and Research said the variant has also been found in the city-state but that containment measures have prevented large-scale spread.
Malaysia's Dr Noor Hisham said the D614G strain detected there was 10 times more infectious and that vaccines currently in development may not be effective against this mutation.
But Dr Tambyah and Dr Maurer-Stroh said such mutations would not likely change the virus enough to make potential vaccines less effective.
"(The) variants are almost identical and did not change areas that our immune system typically recognise, so there shouldn't be any difference for vaccines being developed," said Dr Maurer-Stroh. REUTERS
Read more at https://www.todayonline.com/
Reuters and others have reported:
Dr Paul Tambyah, senior consultant at the National University of Singapore and president-elect of the US-based International Society of Infectious Diseases, said the D614G mutation has also been found in Singapore.
Dr Tambyah said most viruses tend to become less virulent as they mutate.
"It is in the virus' interest to infect more people but not to kill them because a virus depends on the host for food and for shelter," he said.
Scientists discovered the mutation as early as February and it has circulated in Europe and the Americas, the World Health Organization said. The WHO has also said there is no evidence the mutation has led to more severe disease.
Australians must wonder why they do not hear opinion such as Tambyah's and are instead fed with a stream of (contradictory) slogans which are meant to justify locking down the economy.
"It is in the virus' interest to infect more people but not to kill them because a virus depends on the host for food and for shelter," he said.
Scientists discovered the mutation as early as February and it has circulated in Europe and the Americas, the World Health Organization said. The WHO has also said there is no evidence the mutation has led to more severe disease.
Australians must wonder why they do not hear opinion such as Tambyah's and are instead fed with a stream of (contradictory) slogans which are meant to justify locking down the economy.
The question that must be answered now is this: are Australia's elimination type lockdown policies destroying health and the economy?
TO BE READ WITH
Infectious Covid-19 mutation may be 'a good thing', says disease expert Paul Tambyah
Dr Paul Tambyah, senior consultant at the National University of Singapore and president-elect of the US-based International Society of Infectious Diseases, said the D614G mutation has also been found in Singapore.
Published18 AUGUST, 2020UPDATED 18 AUGUST, 2020
SINGAPORE — An increasingly common mutation of the novel coronavirus found in Europe, North America and parts of Asia may be more infectious but appears less deadly, according to a prominent infectious diseases doctor.
Dr Paul Tambyah, senior consultant at the National University of Singapore and president-elect of the International Society of Infectious Diseases, said evidence suggests the proliferation of the D614G mutation in some parts of the world has coincided with a drop in death rates, suggesting it is less lethal.
"Maybe that's a good thing to have a virus that is more infectious but less deadly," Dr Tambyah told Reuters.
Dr Tambyah said most viruses tend to become less virulent as they mutate.
"It is in the virus' interest to infect more people but not to kill them because a virus depends on the host for food and for shelter," he said.
Scientists discovered the mutation as early as February and it has circulated in Europe and the Americas, the World Health Organization said. The WHO has also said there is no evidence the mutation has led to more severe disease.
On Sunday (Aug 16), Malaysia's director-general of health Noor Hisham Abdullah urged greater public vigilance after authorities detected what they believe was the D614G mutation of the coronavirus in two recent clusters.
Dr Sebastian Maurer-Stroh of Singapore's Agency for Science, Technology and Research said the variant has also been found in the city-state but that containment measures have prevented large-scale spread.
Malaysia's Dr Noor Hisham said the D614G strain detected there was 10 times more infectious and that vaccines currently in development may not be effective against this mutation.
But Dr Tambyah and Dr Maurer-Stroh said such mutations would not likely change the virus enough to make potential vaccines less effective.
"(The) variants are almost identical and did not change areas that our immune system typically recognise, so there shouldn't be any difference for vaccines being developed," said Dr Maurer-Stroh. REUTERS
Read more at https://www.todayonline.com/
In &12
Finally we show the insertion in this 1770 bases SPIKE region of a significant EIE from Plasmodium Yoelii and of a possible HIV1 EIE with a crucial Spike mutation.
We analyze the region 1801 to 1899 of Spike, its 33 amino acids contain an important mutation of Spike.
GGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCA
GA TCAACTTACTCCTACTTGG
End of April 2020, Bette Korber, from the Los Alamos National Laboratory, in New Mexico, claimed that a strain
carrying a mutation called S-D614G seemed to take precedence over the others when it competed in a given
geographic territory.
In vitro studies at the Scripps Research Department of Immunology and Microbiology of Florida have just
confirmed this theory today. When they had this mutation, viruses more easily infected human cells in vitro [32].
This mutation identified in early March in Europe, Mexico, Brazil and China, Wuhan, modifies the structure of
the Spike protein. This mutation, S-D614G: a glycine GLY replaced an aspartic acid ASP on codon 614 of protein
Spike.
HIV-1 M:08GQ267 partial pol gene for gag-pol fusion polyprotein precursor, isolate 08GQ267
Sequence ID: FN557340.1Length: 1751Number of Matches: 1
Blast: summary
16/18. 89% identité
If we make the mutation GAT (ASP) ==> GGT (GLY)
This EIE homology with HIV1 is lost.
COVID_19 becomes active if protein S is separated by an enzyme in S1 and S2 which then become functional, without however completely detaching from each other. It's here that the mutation acts: it seems to make the bond more "stable"linking S1 and S2 after action of this enzyme.
The mutation "stabilizes" the virus in its most form effective.
This would explain the predominance of this mutated strain. The mutation is present in 70% of the samples posted on Genbank in May 2020, and it now represents 60% of the strains present in Genbank. This strain has circulated a lot in France, Italy and now in the USA, but almost not in the State of WA studied in our article. If we do not find deletions of this strain in WA, Genbank contains strains where this area is deleted in other places: Australia,
India, USA MAsachussets, CAlifornia, UTah, and especially FLorida.
As we have shown for other areas of the genome (WA state Seattle), it seems that, here too, the genome is trying to delete this region of the Spike.